Introduction

MicroRNA (miRNA) are short (approximately 22 nt) noncoding RNA molecules that inhibit gene expression by binding to complementary sequence at the 3′ untranslated region (UTR) of (target) genes, including oncogenes and tumor suppressor genes [1],of which miR-24 is an endothelial-specific miRNA. Unlike tissue-specific miRNAs, miR-24 can be distributed in many tissues such as heart, kidney, brain, lung, eye, muscle etc., and is most highly expressed in heart and vascular tissue. Studies have shown that miR-24 participates in cell proliferation, apoptosis, angiogenesis, and differentiation of vascular endothelial cells[2-3]. It has been implicated in various pathophysiological processes like tumors and cardiovascular diseases[4].Abnormal expression of miR-24 can not only lead to the occurrence and development of tumor, but also related to many non-tumor diseases such as nervous system diseases and cardiovascular diseases.

Vascular endothelium is a mechanical barrier between circulating blood and vascular smooth muscle, which can make the blood vessel contract and relax. It also can receive and transmit information via secreting vasoactive substances. It plays a key role in the regulation of cardiac function. Wallace and his colleagues[5]confirmed that endothelial dysfunction can promote the development of hypertension. eNOS acts as a rate-limiting enzyme to mediate endothelial NO production, which not only maintains normal vasodilation, but also inhibits platelet aggregation and repairs endothelial damage[6-8]. Fiedler et al [9] found that knockout of miR-24 gene can result in endothelial cell apoptosis. Previous studies have shown that miR-24 can inhibit the proliferation of endothelial cells by regulating the expression of eNOS in vitro, and inhibit the synthesis and release of NO by inhibiting the expression of eNOS [10-11]. The activity of eNOS can affect plasma NO level, leading to the development of chronic hypertension [12]. However, studies on miR-24 in animals have not been reported.

In summary, the purpose of this study was to investigate the effect of miR-24 on the regulation of blood vessel eNOS expression and plasma NO production in rats. This research may implicate miR-24’s potential application as a target for the therapies of cardiovascular diseases such as hypertension.

Materials and methods

Animals

20 healthy SD male rats weighing 180-220 g were obtained from the Experimental Animal Centre of Guangxi Medical University (SYXK2014-0002).The rats were housed under standard conditions (20-25 ℃,50%-60% humidity, with a 12 h light-dark cycle) and were given standard roden chow and free access to water.Rats were randomly divided into 2 groups: miR-24 and blank plasmid group.

Materials

X-treme GENE HP DNA Transfection Kit (Roche, Germany); Plasmid Extraction Kit (Qiagen, Germany); ELISA Enzyme Immunoassay Kit (Nanjing Jiancheng, China); Nitrate Reduction Test Kit (Nanjing Jiancheng,China); Rotary microtome (Leica RM2235, Germany); Cryomicroscope (Leica CM1100, Germany); Inverted microscope (Olympus, Japan); eNOS rabbit-derived monoclonal antibody (Abcam, UK).

Plasmid construction for the over-expression of miR-24

The miR-24 sequence (http://www.miRbase.org) is 5′-UGGCUCAGUUCAGCAGGAACAG-3′, and the blank plasmid is the random sequence 5′-GUCAUCAGUCGAGCUAGACGAG-3′. The constructed plasmids were labeled by green fluorescent protein. The first strand DNA was synthesized using DNA synthesis technology, and then double strand DNA was synthesized by DNA ligation reaction, followed by polymerase chain reaction (PCR) amplification and in vitro recombination, and finally inserted into the pEGP-miR vector. The vector termed pEGP-miR-24 was transformed into competent cell of E. coli DH5α. Recombinant clones were confirmed by restriction enzyme digestion. The plasmid DNA was extracted after shaking, and the concentration was determined using a NANO nucleic acid analyzer.

Procedure for in vivo transfection of rat [11-12]

Rats in the miR-24 group were injected with plasmid DNA in saline via the tail vein every 2 days for 2 consecutive months, and rats in the blank plasmid group were injected with the same dose of blank plasmid. The injected saline volume corresponded to approximately 8%-9% of the rats′ body weight and the injection was completed in <5 s.

Histological analysis

After 2 months of transfection, the animals were intraperitoneally anesthetized with 10% chloral hydrate. Arterialtissues were removed and fixed in 10% formaldehyde solutionat room temperature for 48 h. Subsequently, the samples were embedded in paraffin and sectioned longitudinally at 5 μm. The vessel sections were stained with hematoxylin & eosin (H&E) and examined using a Leica CM1100 microscope. Images were taken using an Olympus BX53 F microscope (Tokyo, Japan) and analyzed with the Leica Application Suite (LAS) digital image processing software (Leica).

Determination of eNOS activity in plasma

Blood was collected from the abdominal aorta and after centrifugation, the supernatant was used for analysis. The activity of eNOS was determined by commercial ELISA kit according to the manufacturer′s in structions. The OD value of each well at a wavelength of 450 nm was measured within 10 min in a microplate reader.

Measurement of NO level in plasma

The plasma NO content was measured using a Nitrate Reduction Test Kit according to the manufacturer′s instructions.

Immunohistochemistry for the expression of eNOS protein in vascular tissue

After deparaffinization and rehydration, the vessel sections were treated with 3% H2O2 for 40 min, followed by 0.01 mol/L citric acid in saline buffer at 95-98 ℃ for about 5 min.The sections were then place in 7% non-fat milk for 30 min to block non-specific background staining, and incubated over-night at 4 ℃ with eNOS antibody (1∶400, Abcam). After washing, the sections were incubated for 1 h with HRP-conjugated secondary antibody.Diaminobenzidine (DAB) was employed to detect the immuno-complex, and hematoxylin was used for nuclear counter staining. Images were taken using a Leica CM1100 microscope and analyzed using LAS imaging processing software.

Statistical analysis

Results were expressed as mean±SD. Statistical analyses were conducted using SPSS software version 19.0 software (SPSS Inc, Chicago, IL, USA). T test was used for statistical analysis. P-value<0.05 was considered to be statistically significant.

Results

Fluorescence distribution of miR-24 inratvascular tissues

As shown in Fig. 1,green fluorescence could be visible in both groups of rat vascular tissues by fluorescence microscopy. The results suggested that the miR-24 plasmid has been successfully transferred into rat arterial tissue.

  

Fig. 1 Green fluorescent protein expression in rat vascular tissue observed under fluorescence microscope (×200).a:miR-24 group; b:blank plasmid group.

The effect of miR-24 on vascular morphology

HE staining showed that the vascular tissue layers were tightly structured, the inner membrane was smooth, and the elasticfibers of the media were normal in the blank plasmid group. There was no significant difference in the morphology of vascular tissues between the two groups(Figure 2).The results suggested that miR-24 has no significant effect on vascular morphology within 8 weeks.

  

Fig. 2 HE staining of vascular tissues (×400).a:miR-24 group; b:blank plasmid group.

Effect of miR-24 on the expression of eNOS protein in arterial vascular tissue

Immunohistochemistry staining of the arterial vascular tissue showed that the eNOS protein expression was lower in the miR-24 group than that in the blank plasmid group (Figure 3).

  

Fig. 3 Immunohistochemical staining of vascular tissues (×400). The nuclei were stained blue, and the target proteins were stained brown. a:miR-24 group; b:blank plasmid group.

Effect of miR-24 on the activity of eNOS in rats

Compared with the blank plasmid group, the eNOS activity in the miR-24 group was significantly decreased (P<0.05) (Figure 4).

  

Fig. 4 Activity of eNOS in rat plasma,a:miR-24 group;b:blank plasmid group. *P<0.05 vs. blank plasmid group. Data is presented as means±SD (n=10).

Effect of miR-24 on NO content in plasma

After transfection of miR-24 over-expression plasmid, the concentration of NO in plasma was reduced by 56.02% (P<0.01), compared with the blank plasmid group(Figure 5).

  

Fig. 5 The plasma NO level in plasma.a:miR-24 group;b:blank plasmid group. **P<0.01 vs. blank plasmid group. Data is presented as means±SD (n=10).

Discussion

MiR-24 is an endothelial miRNA with specific regulation of endothelial cell function. In 2001, some researchers discovered miR-24 and identified its structural sequence as 5′-UGGCUCAGUUCAGCAGGAACAG-3′[13]. It has been reported that human miR-24 consists of two species, miR-24-1 and miR-24-2,where the genes are located in 9q22 and 19p13, respectively [14].MiR-24 is highly conserved between species, with identical human (hsa-miR-24-3p) and murine (mmu-miR-24-3p) mature sequence (UGGCUCAGUUCAGCAGGAACAG)[15]. In mice, chromosome encoding miR-24-1 and 2 are located at No. 8 and No.13 chromosomes[16], a finding that provides a theoretical basis for the role of our study in animal models of miR-24.

By up-regulating miR-24 expression,eNOS was down-regulated, and NO synthesis level was decreased, causing sustained contraction of blood vessels.In this study, after continuous administration of miR-24 plasmid for 8 weeks, we found that the expression of eNOS in rat arterial vascular tissue was reduced compared with the blank plasmid group. MiR-24 inhibits the proliferation, apoptosis, angiogenesis, inflammatory response, and differentiation of endothelial cells by participating in the regulation of the expression of eNOS, a tissue-specific gene. The abnormal expression of miR-24 disrupts the function of endothelial cells, resulting in the balance of blood pressure in the body.There may be two mechanisms for the regulation of eNOS by miR-24: (1) miR-24 directly inhibits the expression of eNOS in the transcriptional stage; (2) miR-24 indirectly regulates the expression of eNOS through the alternative pathway that inhibits nuclear transcription factor Sp1[10, 17].Studies have shown that over-expression of miR-24 significantly inhibits the proliferation of human umbilical vein endothelial cells (HU-VECs) and the expression of eNOS. miR-24 plays a key role in the regulation of eNOS gene expression [18].

Vascular endothelium acts as a mechanical barrier to both blood and vascular smooth muscle, and exerts an important endocrine function that synthesizes and releases a variety of endothelial-derived vasoactive factors. eNOS is a tissue-specific gene, and NO generated by rate-limiting is not only a relaxation factor that regulates vascular tone, but also plays a crucial role in the growth and migration of vascular endothelial cells and the maintenance of normal diastolic function of eNOS [8, 19].For example, Lee and his colleagues [20] found that increased expression of eNOS can reduce pulmonary hypertension, which may be related to eNOS activity and NO synthesis.In this study,we found that the activity of eNOS in the miR-24 group was significantly lower than that of the blank plasmid group, and there was a significant difference in serum NO level between the two groups, and the miR-24 group was significantly lower(P<0.05).Therefore, by regulating the expression level of miR-24, regulating eNOS activity of vascular endothelial cells and promoting the synthesis of NO, it is beneficial to the protection of vascular endothelial cells, and can reasonably use the NO in blood vessel wall to maintain the normal vasodilation of blood vessels. And it can inhibit the excessive proliferation and migration of smooth muscle cells stimulated by oxidative stress, which is beneficial to the repair of vascular endothelial injury and avoid the formation of stenosis. At the same time, the proliferation of fibrocytes is restricted, the occurrence of perivascular and interstitial fibrosis is prevented, and the expansion of the vascular wall can be maintained [3].

In conclusion, this study demonstrated that up-regulation of miR-24 could reduce the expression of eNOS in arterial vascular tissue of rats and eNOS activity, and inhibit the release of endothelial NO.MiR-24 might be a potential therapeutic target in the treatment of cardiovascular diseases.However, whether the effect of miR-24 is dose-dependence and time-dependence still needs to be further explored.

Conflict of interest The authors have declared that no conflict of interest exists.

References:

[1] Volinia S, Calin G A, Liu C G, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. ProcNatl Acad Sci USA, 2006,103(7):2257-2261.

[2] Meloni M, Marchetti M, Garner K, et al. Local inhibition of microRNA-24 improves reparative angiogenesis and left ventricle remodeling and function in mice with myocardial infarction. Mol Ther,2013,21(7):1390-1402.

[3] Chen W, Ou H S. Regulation of miR-24 on vascular endothelial cell function and its role in the development of cardiovascular disease. Sheng Li Xue Bao,2016, 68(2): 201-206.

[4] Wang L, Qian L. miR-24 regulates intrinsic apoptosis pathway in mouse cardiomyocytes. PLoS One,2014, 9(1): e85389.

[5] Wallace S M, Yasmin, McEniery C M, et al. Isolated systolic hypertension is characterized by increased aortic stiffness and endothelial dysfunction. Hypertension, 2007, 50(1): 228-233.

[6] Huang P L. eNOS, metabolic syndrome and cardiovascular disease. Trends Endocrinol Metab, 2009, 20(6): 295-302.

[7] Yang P, Zhang Y, Pang J, et al. Loss of Jak2 impairs endothelial function by attenuating Raf-1/MEK1/Sp-1 signaling along with altered eNOS activities. Am J Pathol,2013,183(2): 617-625.

[8] Wang B, Xing F, Liu N, et al. p38α subtype is a potential target to inhibit eNOS activity and NO production in human endothelial cells. Microvasc Res, 2014, 91: 58-65.

[9] Fiedler J, Jazbutyte V, Kirchmaier B C, et al. MicroRNA-24 regulates vascularity after myocardial infarction. Circulation, 2011, 124(6): 720-730.

[10] Zhang W, Yan L, Li Y, et al. Roles of miRNA-24 in regulating endothelial nitric oxide synthase expression and vascular endothelial cell proliferation. Mol Cell Biochem, 2015, 405(1-2): 281-289.

[11] Luo L X, Chen W, Mo J G, et al.Effects of miRNA-24 on the eNOS expression/activity and the production of its metabolite NO in vascular endothelial cells.Journal of International Pharmaceutical Research,2017,44(3):245-250.

[12] Thomas G D, Zhang W, Victor R G. Nitric oxide deficiency as a cause of clinical hypertension: promising new drug targets for refractory hypertension. JAMA, 2001, 285(16): 2055-2057.

[13] Lagos-Quintana M, Rauhut R, Lendeckel W, et al. Identification of novel genes coding for small expressed RNAs. Science, 2001,294(5543):853-858.

[14] Gibcus J H, Tan L P, Harms G, et al. Hodgkin lymphoma cell lines are characterized by a specific miRNA expression profile. Neoplasia, 2009,11(2):167-176.

[15] Fordham J B, Naqvi A R, Nares S. miR-24 regulates macrophage polarization and plasticity. J Clin Cell Immunol, 2015,6(5): 362.

[16] Sun Q, Zhang Y, Yang G, et al. Transforming growth factor-beta-regulated miR-24 promotes skeletal muscle differentiation. Nucleic Acids Res, 2008,36(8):2690-2699.

[17] Yan L, Kang M, Qin Z, et al. An intronic miRNA regulates expression of the human endothelial nitric oxide synthase gene and proliferation of endothelial cells by a mechanism related to the transcription factor SP-1. PLoS One, 2013,8(8):e70658.

[18] Zhang W Y, Wang H, Li Y M, et al.Role of miRNA-24 in regulation of endothelial nitric oxide synthase ex-pression and vascular endothelial cell proliferation.Chinese Journal of Pathophysiology,2014,(8):1415-1420.

[19] Huang J J, Shi YQ, Li R L, et al. Angiogenesis effect of therapeutic ultrasound on HUVECs through activation of the PI3K-Akt-eNOS signal pathway. Am J Transl Res, 2015, 7(6): 1106-1115.

[20] Lee H, Lee J C, Kwon J H, et al. The effect of umbilical cord blood derived mesenchymal stem cells in monocrotaline-induced pulmonary artery hypertension rats. J Korean Med Sci, 2015, 30(5): 576-585.